Real Science Radio: Bergman on Whale Evolution

Jefferson

Administrator
Staff member
Administrator
Super Moderator
Bergman on Whale Evolution on Real Science Radio

This is the show from Friday February 22nd, 2013

SUMMARY:



* RSR with the Most Prolific Creationist Writer[/b]: Real Science Radio's Bob Enyart interviews Dr. Jerry Bergman, author of Whale Evolution: A Whale of a Tale. Dr. Bergman's degrees include Ph.D.s from the University to Toledo, Bowling Green, and Wayne State University. He has authored hundreds of publications and many books, including Slaughter of the Dissidents, Vestigial Organs Are Fully Functional, and his latest, Hitler and the NAZI Darwinian Worldview.

* Land-Dwelling Rodhocetus Keeps Whale Ancestor Job: The discoverer of Rodhocetus, Dr. Philip Gingerich, wanted it to be a whale ancestor and so he drew it as a marine creature with fluked tail and front flippers. Now that enough of the skeleton has been discovered to accurately identify it as a land dweller, dramatically different from what qualified it as a reputed whale ancestor, the evolutionists insist on keeping it in the whale's lineage anyway. Ha! It's too big to fail! In a videotaped interview with RSR friend Dr. Carl Werner, Rodhocetus discoverer Gingerich now admits:

"I speculated that it might have had a fluke [whale-like tail], I now doubt that Rodhocetus would have had a fluked tail." [And regarding the imaginative whale-like flippers he had included in his reconstruction of the partial fossil, Gingerich also admitted] "Since then we have found the forelimbs, the hands, and the front arms of Rodhocetus, and we understand that it doesn't have the kind of arms that can spread out like flippers on a whale."



* Do Whales Have Vestigial Pelvic Bones? Dr. Bergman is an expert on the fanciful history of allegedly vestigial organs and their fading support for Darwinism. Not only do whales not have vestiges of leg or pelvic bones nor fetal teeth, at RealScienceRadio.com/eye, a University of California professor made a vestigial argument for the evolution of the human eye, which Dr. Bergman helped Bob Enyart to rebut.

* Left-wing Slaughter of Those Who Think Differently: Dr. Bergman has published online the names of 3,000 scientists and professors who reject secular Darwinism to varying degrees, (out of the hundreds of thousands of Darwin Doubters who are scholars, doctors, and Ph.D.s in various fields of science). Yet, undoubtedly motivated by fear of opposition, Bergman documents in his Slaughter of the Dissidents how the Darwin marketing reps manage to ruin the careers of, and even fire, the scientists who question Darwinism. (This very day, a close friend of RSR and scientist at a major state university system has been threatened with firing within a week of getting published in a leading, secular peer-reviewed scientific journal. His crime? His outstanding work calls into question the methods used for claiming that the Earth is 4.55 billion years old.)

* Bergman on Real Science Radio: If you enjoyed today's program, you're invited to listen to these other great Bergman shows:
- Bergman, Bats & Bellybuttons
- Jerry Bergman on the Slaughter of the Dissidents
- RSR on Bergman's Origin of Language Paper
- RSR on Bergman's Origin of Fish
- RSR on Bergman's Origin of Trees

Today’s Resource: Getting the BEL Science Pack, learn and have a great time, support Bob Enyart Live, and save a lot of money, all at the same time! You can consider our BEL Science Pack and enjoy:

- Dr. Guillermo Gonzalez’ Privileged Planet (clip)
- Illustra Media’s Unlocking the Mystery of Life (clip)
- Walt Brown’s In the Beginning
- Bob Enyart’s Age of the Earth Debate between him and a geo-physicist, and
- Bob's Genesis: Creation verse-by-verse Bible Study!

And have you browsed through the entire Science Department in our KGOV Store? Check out especially Bob’s interviews with a great scientist in Hydroplate Theory & Walt Brown On the Air! You’ll also love the superb kids radio programming, Jonathan Park: The Adventure Begins! And to order any of our BEL and 3rd-party resources, just call us at 1-800-8Enyart.
 
Last edited by a moderator:

Alate_One

Well-known member
* Do Whales Have Vestigial Pelvic Bones? Dr. Bergman is an expert on the fanciful history of allegedly vestigial organs and their fading support for Darwinism. Not only do whales not have vestiges of leg or pelvic bones nor fetal teeth, at RealScienceRadio.com/eye, a University of California professor made a vestigial argument for the evolution of the human eye, which Dr. Bergman helped Bob Enyart to rebut.
Oh no no, they don't have remnants of pelvic bones, and there aren't fossil whales with legs, no embryonic dolphins with hind limb buds, no whales with chambered stomachs (like cows), no DNA similarity with cows and hippos.

Nope that's all a figment of the scientist's imagination. Well at least that's what Bob hopes everyone believes that listens to Pseudoscience radio. :p

HMPBK02.JPG

Whale pelvic remnants

dorudon_skeleton.gif

Dorudon - fossil whale

dolphin_embryo.jpg

Dolphin embryo - H marks the hind limb

83677592.pSnxpVPZ.jpg

Whale stomachs

Alignment of milk proteins from cow, whale and mouse showing a higher similarity between cows and whales than mice.

Code:
Cow             AGTCCCC----AAAGTGAAGGAGACTATGGTTCC 30
Mouse           AATCCTTCCTTAAAGCTAAAGCCACCATCCTTCC 420
Rt.  Whale      AATCCCC----AAAGCTAAGGAGACTATCCTTCC 30
                * ***      ****  ** *  ** **  ****

Cow             TAAGCACAAGGAAATGCCCTTCCCTAA----------------------ATA-------- 60
Mouse           CAAGCACAAACAGATGCCCCTCCTTAACTCTGAAACTGTGCTCCGCCTCATAAACTCTCA 480
Rt.  Whale      TAAGCATAAAGAAATGCCCTTCCCTAT----------------------ATC-------- 60
                ***** **  * ****** *** **                       **
 

Frayed Knot

New member
That whole Rodhocetus thing that Enyart is always bringing up just shows how dishonest the creationists are. They had enough of the skeleton to solidly classify it as a whale ancestor. They didn't have some of the bones, but the ones they did have were slam-dunk evidence for its lineage. Then, when drawing the animal to help people imagine it, they had to guess on the bones that they didn't have. And some of those guesses turned out to be incorrect when we did finally find more skeletons.

So what? It doesn't cast any doubt on the fact that these creatures were ancestors of modern whales. The bones that Gingerich had initially were all the evidence it took to establish that without a doubt.
 

Lighthouse

The Dark Knight
Gold Subscriber
Hall of Fame
That whole Rodhocetus thing that Enyart is always bringing up just shows how dishonest the creationists are. They had enough of the skeleton to solidly classify it as a whale ancestor. They didn't have some of the bones, but the ones they did have were slam-dunk evidence for its lineage. Then, when drawing the animal to help people imagine it, they had to guess on the bones that they didn't have. And some of those guesses turned out to be incorrect when we did finally find more skeletons.

So what? It doesn't cast any doubt on the fact that these creatures were ancestors of modern whales. The bones that Gingerich had initially were all the evidence it took to establish that without a doubt.
The problem is that most of the offerings of evolutionists are guesswork.
"We think it looked like this..."

That means they don't actually know. And, as you pointed out, they end up being wrong when they do that.

And their classification is the same way; all we can know for certain is that an extinct creature is somewhat related to a currently living creature in the way lions and leopards or wolves and foxes are related. They don't know it was an actual ancestor [whales evolved from them].
 
Top